View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_39 (Length: 254)
Name: NF0253_low_39
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_low_39 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 34 - 189
Target Start/End: Original strand, 39608768 - 39608923
Alignment:
Q |
34 |
ttgtggctgttttatagatttagtatcaaataattgttcttgtttcttatattttataatggagggaatacataattacgattaaatagacttacttttt |
133 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39608768 |
ttgtggctgttttatagatttagtatcaaataattgttcttgtttcttatattttataatggagggaatacataattacgattaaatagacttacttttt |
39608867 |
T |
 |
Q |
134 |
tagttatactccattttgttacggaagagggagtatataatttcaatcaaatatat |
189 |
Q |
|
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
T |
39608868 |
tagttatactccattttgtcacggaagagggagtatataatttcaatcaaatatat |
39608923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University