View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0253_low_43 (Length: 249)

Name: NF0253_low_43
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0253_low_43
NF0253_low_43
[»] chr4 (2 HSPs)
chr4 (10-220)||(34685713-34685918)
chr4 (11-147)||(34693574-34693711)
[»] scaffold0777 (1 HSPs)
scaffold0777 (111-197)||(5509-5595)


Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 34685918 - 34685713
Alignment:
10 atgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaact 109  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
34685918 atgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaact 34685819  T
110 taacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacggatactagctagaatacaaatgtataaaactggacacat 209  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||     | |||||||||||||||||||||||||||||||    
34685818 taacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacgg-----aactagaatacaaatgtataaaactggacacat 34685724  T
210 tagaaacaaac 220  Q
    |||||||||||    
34685723 tagaaacaaac 34685713  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 34693711 - 34693574
Alignment:
11 tgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaactt 110  Q
    ||||| || ||| |||||||||||||||   |||||||||||||||||||| |||||||||||| ||||||| |||||| ||||   |||||||||||||    
34693711 tgaacttgtttgaccaatgtactttcttgaagggagccatcactgatcgattgttgatatgctgggatagatggagaaattaagacgaattattgaactt 34693612  T
111 -aacctaaatatcaaaagatagagatgattattagaga 147  Q
     ||||| |||||  ||||||| ||||||||||||||||    
34693611 gaacctgaatattgaaagatatagatgattattagaga 34693574  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0777 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0777
Description:

Target: scaffold0777; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 111 - 197
Target Start/End: Complemental strand, 5595 - 5509
Alignment:
111 aacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacggatactagctagaatacaaatgtataa 197  Q
    ||||||||||||||||||| |||| ||||| |||||| |||||||||  ||||||||  |||||||| ||||||||||||| |||||    
5595 aacctaaatatcaaaagattgagaagattagtagagagaagtactagaatttataaagaggatactaactagaatacaaatttataa 5509  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University