View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_43 (Length: 249)
Name: NF0253_low_43
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_low_43 |
 | |
|
| [»] scaffold0777 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 187; Significance: 1e-101; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 10 - 220
Target Start/End: Complemental strand, 34685918 - 34685713
Alignment:
| Q |
10 |
atgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaact |
109 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34685918 |
atgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaact |
34685819 |
T |
|
| Q |
110 |
taacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacggatactagctagaatacaaatgtataaaactggacacat |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
34685818 |
taacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacgg-----aactagaatacaaatgtataaaactggacacat |
34685724 |
T |
|
| Q |
210 |
tagaaacaaac |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
34685723 |
tagaaacaaac |
34685713 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 11 - 147
Target Start/End: Complemental strand, 34693711 - 34693574
Alignment:
| Q |
11 |
tgaacctgcttggccaatgtactttcttcctgggagccatcactgatcgatcgttgatatgctgcgatagatagagaaagtaagggaaattattgaactt |
110 |
Q |
| |
|
||||| || ||| ||||||||||||||| |||||||||||||||||||| |||||||||||| ||||||| |||||| |||| ||||||||||||| |
|
|
| T |
34693711 |
tgaacttgtttgaccaatgtactttcttgaagggagccatcactgatcgattgttgatatgctgggatagatggagaaattaagacgaattattgaactt |
34693612 |
T |
|
| Q |
111 |
-aacctaaatatcaaaagatagagatgattattagaga |
147 |
Q |
| |
|
||||| ||||| ||||||| |||||||||||||||| |
|
|
| T |
34693611 |
gaacctgaatattgaaagatatagatgattattagaga |
34693574 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0777 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0777
Description:
Target: scaffold0777; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 111 - 197
Target Start/End: Complemental strand, 5595 - 5509
Alignment:
| Q |
111 |
aacctaaatatcaaaagatagagatgattattagagataagtactaggttttataaaacggatactagctagaatacaaatgtataa |
197 |
Q |
| |
|
||||||||||||||||||| |||| ||||| |||||| ||||||||| |||||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
5595 |
aacctaaatatcaaaagattgagaagattagtagagagaagtactagaatttataaagaggatactaactagaatacaaatttataa |
5509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1174 times since January 2019
Visitors: 2573