View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_46 (Length: 241)
Name: NF0253_low_46
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_low_46 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 196; Significance: 1e-107; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 196; E-Value: 1e-107
Query Start/End: Original strand, 23 - 230
Target Start/End: Original strand, 39892848 - 39893055
Alignment:
Q |
23 |
atgttccacaacccttagattcacaccctcaacctcagaagataaacaaccctgtcactcttcaatctcatctctccaaacctaataccgaacaagaaca |
122 |
Q |
|
|
||||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39892848 |
atgttccacaacccttatattcacaccctcaacctcagaagaaaaacaaccctgtcactcttcaatctcatctctccaaacctaataccgaacaagaaca |
39892947 |
T |
 |
Q |
123 |
aactttcaacaaaccttctgataatattccaaacaatgaaaacaactcactccaagagcttcaaaatctcattcaacaagcactcaataaccatgccttc |
222 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
T |
39892948 |
aactttcaacaaaccttctgataatattccaaacaatgaaaacaactcactccaagagcttcaaaatctcattcaacaagcattcaataaccatgccttc |
39893047 |
T |
 |
Q |
223 |
tctgctcc |
230 |
Q |
|
|
|||||||| |
|
|
T |
39893048 |
tctgctcc |
39893055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1266 times since January 2019
Visitors: 2574