View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_49 (Length: 226)
Name: NF0253_low_49
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 134; Significance: 7e-70; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 2 - 147
Target Start/End: Complemental strand, 29281227 - 29281082
Alignment:
| Q |
2 |
cttaatatcataccagcttttttggcagctctacacaatgcttctttaatgagaagctgtgcagggtctatctctggtgataaagtgatgaatgactcca |
101 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29281227 |
cttaatatcataccagcttttttggcagctctacataatgcttctttaatgagaagctgtgcagggtctatctctggtgataaagtgatgaatgactcca |
29281128 |
T |
 |
| Q |
102 |
ctttagcaactgcttcttcattggtgaaatattgatgatgtccatc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
29281127 |
ctttagcaactgcttcttcattggtgaaatattggtgaagtccatc |
29281082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 86 - 135
Target Start/End: Original strand, 21969071 - 21969120
Alignment:
| Q |
86 |
gtgatgaatgactccactttagcaactgcttcttcattggtgaaatattg |
135 |
Q |
| |
|
|||||||||||||| |||||||| | |||||||||||||||||| ||||| |
|
|
| T |
21969071 |
gtgatgaatgactctactttagccattgcttcttcattggtgaagtattg |
21969120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University