View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_53 (Length: 221)
Name: NF0253_low_53
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0253_low_53 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 54; Significance: 4e-22; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 63 - 124
Target Start/End: Original strand, 36708270 - 36708331
Alignment:
Q |
63 |
tattacgaatactcactttctaccaccgactctcttattgagtagaatagaacctgcatttt |
124 |
Q |
|
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
T |
36708270 |
tattacgaatactcactttctatcaccgactctcttattgagtggaatagaacctgcatttt |
36708331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 49; E-Value: 3e-19
Query Start/End: Original strand, 1 - 53
Target Start/End: Original strand, 36708136 - 36708188
Alignment:
Q |
1 |
ataaggcttatcaatttaattcaaccaaaacagttatttgctgtcttaaaaaa |
53 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
36708136 |
ataaggcttatcaatttaattcaaccaaaacagttatttgttgtcttaaaaaa |
36708188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University