View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_54 (Length: 206)
Name: NF0253_low_54
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 1 - 194
Target Start/End: Complemental strand, 14209509 - 14209316
Alignment:
| Q |
1 |
tatgtgcatgtataattattcctcaggtgaaggttttgtccttgtcaatttttcttgttttatgaggcttgtccttacctcagttatgttacttaacaaa |
100 |
Q |
| |
|
||||||||||||||||||| ||||||| ||||| |||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
14209509 |
tatgtgcatgtataattatgcctcagggaaaggtattgtccttgtcagtttttcttgttttatgaggcttgtccttacctcagttatgttacttaaaaaa |
14209410 |
T |
 |
| Q |
101 |
tgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttgggttctgtttggattggtttatttgagtttatttactagtat |
194 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14209409 |
tgtcacgacaatggcaattcatctaaattgaactcaacaaattcagcacttaggttctgtttggattggtttatttgagtttatttactagtat |
14209316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 31; Significance: 0.00000002; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 158 - 196
Target Start/End: Complemental strand, 26717378 - 26717340
Alignment:
| Q |
158 |
tgtttggattggtttatttgagtttatttactagtatta |
196 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
26717378 |
tgtttggattggtttatttgagtttatctactagcatta |
26717340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 188
Target Start/End: Original strand, 36643794 - 36643826
Alignment:
| Q |
156 |
tctgtttggattggtttatttgagtttatttac |
188 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
36643794 |
tctgtttggattggtttatttgagcttatttac |
36643826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.00000007; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 156 - 189
Target Start/End: Complemental strand, 25719824 - 25719791
Alignment:
| Q |
156 |
tctgtttggattggtttatttgagtttatttact |
189 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
25719824 |
tctgtttggattgatttatttgagtttatttact |
25719791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 156 - 184
Target Start/End: Complemental strand, 7941759 - 7941731
Alignment:
| Q |
156 |
tctgtttggattggtttatttgagtttat |
184 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
7941759 |
tctgtttggattggtttatttgagtttat |
7941731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University