View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0253_low_57 (Length: 205)
Name: NF0253_low_57
Description: NF0253
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0253_low_57 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 125
Target Start/End: Complemental strand, 44956167 - 44956043
Alignment:
| Q |
1 |
atatggatttggtcttacataacaaactaggtccaatgcacatcatacaatccacaactaactaattctctaactaacacaattaaaattgatttatact |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44956167 |
atatggatttggtcttacataacaaactaggtccaatgcacatcatacaatccacaactaactaattctctaactaacacaattaaaattgatttatact |
44956068 |
T |
|
| Q |
101 |
tcactcataacaggattttcttcga |
125 |
Q |
| |
|
|||||||||||||| |||||||||| |
|
|
| T |
44956067 |
tcactcataacagggttttcttcga |
44956043 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University