View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254-INSERTION-15 (Length: 147)
Name: NF0254-INSERTION-15
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254-INSERTION-15 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 7e-72; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 7e-72
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 40925076 - 40925216
Alignment:
| Q |
7 |
aattcacaaatatttacctgtgctggttgaaatctggggataatatagagatgaatgtgcaccttaatgaatcaatttacaaaggaatgaatgttgttta |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925076 |
aattcacaaatatttacctgtgctggttgaaatctggggataatatagagatgaatgtgcaccttaatgaatcaatttacaaaggaatgaatgttgttta |
40925175 |
T |
|
| Q |
107 |
tgcggtgtatgattcattttatatatgatttgtttcattgt |
147 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40925176 |
tgcgctgtatgattcattttatatatgatttgtttcattgt |
40925216 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 503 times since January 2019
Visitors: 2566