View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254-INSERTION-5 (Length: 103)
Name: NF0254-INSERTION-5
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254-INSERTION-5 |
 |  |
|
| [»] chr7 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 103; Significance: 9e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 103
Target Start/End: Complemental strand, 22110968 - 22110866
Alignment:
| Q |
1 |
tcattgtcttgcttgaaatagagttgaaactactgtcaagtgcgccgtttttccctacacattttccattgtttccagtggtagaaagtatagacgcggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22110968 |
tcattgtcttgcttgaaatagagttgaaactactgtcaagtgcgccgtttttccctacacattttccattgtttccagtggtagaaagtatagacgcggc |
22110869 |
T |
 |
| Q |
101 |
tgc |
103 |
Q |
| |
|
||| |
|
|
| T |
22110868 |
tgc |
22110866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 9e-52
Query Start/End: Original strand, 1 - 103
Target Start/End: Original strand, 40583621 - 40583723
Alignment:
| Q |
1 |
tcattgtcttgcttgaaatagagttgaaactactgtcaagtgcgccgtttttccctacacattttccattgtttccagtggtagaaagtatagacgcggc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40583621 |
tcattgtcttgcttgaaatagagttgaaactactgtcaagtgcgccgtttttccctacacattttccattgtttccagtggtagaaagtatagacgcggc |
40583720 |
T |
 |
| Q |
101 |
tgc |
103 |
Q |
| |
|
||| |
|
|
| T |
40583721 |
tgc |
40583723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University