View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_14 (Length: 304)
Name: NF0254_1D_low_14
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_14 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 126; Significance: 5e-65; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 126; E-Value: 5e-65
Query Start/End: Original strand, 106 - 292
Target Start/End: Original strand, 7791923 - 7792113
Alignment:
Q |
106 |
ttcggacacacaaaaacataatatttagtgtgagaaaaatttatatagatagagtgttgttataaatataaattagttat--gagtcatnnnnnnngata |
203 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||| |||| |
|
|
T |
7791923 |
ttcggacacacaaaaacataatatttagtgtgagaaaaatttatataaatagagtgttgttataaatataaattagttatatgagtcataaaaaaagata |
7792022 |
T |
 |
Q |
204 |
gttatttgagttttcttcaccataaactctagtttttggatgtatggaatcttggatagtt---gtctatgtttgagttcatgggaaagatc |
292 |
Q |
|
|
||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |||||||||||| |
|
|
T |
7792023 |
gttatttgagttt-catcaccataaactctagtttttggatgtatggaatcttggatagttgtcgtctatgtttgagtttatgggaaagatc |
7792113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University