View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_18 (Length: 273)
Name: NF0254_1D_low_18
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 137; Significance: 1e-71; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 137; E-Value: 1e-71
Query Start/End: Original strand, 86 - 253
Target Start/End: Complemental strand, 32880836 - 32880671
Alignment:
Q |
86 |
aaggatgggttcagcctaaatgccacctatcatgaaacaggttttagtggcaaggcaatgtaatgaaaattattacatggagaaaatgaaaattctcaag |
185 |
Q |
|
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||||| ||||| ||| |
|
|
T |
32880836 |
aaggatgtgttcagcctaaatgccacctatcatgaaacaggttttagtggcaaggcaatgtgatgaaaattattaca--gagaaaatgaagattcttaag |
32880739 |
T |
 |
Q |
186 |
gagagcaatgagttgtgtggttaccttttatatatgatcactatgtactttttatataccgcatctat |
253 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
32880738 |
gagagcaatgagttgtgtggttaccttttatatatgatcactatgtactttttatataccacatctat |
32880671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 24 - 69
Target Start/End: Complemental strand, 32882118 - 32882073
Alignment:
Q |
24 |
caataattgaggaaagcaacatttgaaagcacccacatgttaagag |
69 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32882118 |
caataattgaggaaagcaacatttgaaagcacccacatgttaagag |
32882073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University