View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_27 (Length: 262)
Name: NF0254_1D_low_27
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_27 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 190; Significance: 1e-103; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 7 - 216
Target Start/End: Original strand, 9070980 - 9071189
Alignment:
| Q |
7 |
ataatactcaaaataaaactcatacatctcgtacatccaaaacctcattaaagacaacactcaatcgagggctacggccaaaatcagttacggactaatc |
106 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
9070980 |
ataacactcaaaataaaactcatacatctcgtacatccaaaacctcattaaagacaacactcaatcgagggctaccgccaaaatcagttacggactaatc |
9071079 |
T |
 |
| Q |
107 |
attgtcgcggcacgtagctgttgctagcgaaatattttttgatgccaacgaaaaataaacttaggagcaccgggtcggccctagagtccatggctattca |
206 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| || |||||| |
|
|
| T |
9071080 |
attgtcgcggcacgtagctgttgctagcgaaatatttttttatgccaacgaaaaataaacttaggagcaccgggtcggccctagagtccacggttattca |
9071179 |
T |
 |
| Q |
207 |
ttaaacttag |
216 |
Q |
| |
|
|||||||||| |
|
|
| T |
9071180 |
ttaaacttag |
9071189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 219 - 262
Target Start/End: Original strand, 9071217 - 9071260
Alignment:
| Q |
219 |
aaaaccaatggatatggtgacaaatagcctaaaccagtaacagt |
262 |
Q |
| |
|
|||||||||||||||| ||| ||||||||||||||||||||||| |
|
|
| T |
9071217 |
aaaaccaatggatatgatgataaatagcctaaaccagtaacagt |
9071260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University