View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_28 (Length: 260)
Name: NF0254_1D_low_28
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_28 |
 |  |
|
| [»] chr2 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 233; Significance: 1e-129; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 233; E-Value: 1e-129
Query Start/End: Original strand, 1 - 260
Target Start/End: Complemental strand, 14810827 - 14810565
Alignment:
| Q |
1 |
tagagtttttgccagtcattgcagttcctgatatgattagattgatggttgacttgaagttaatcttcttatcaacaaatctcatttggtttctgcaaaa |
100 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
14810827 |
tagagttgttgccagtcattgcagttcctgatatgattagattgatggctgacttgaagttaatcttcttatcaacaaatctcatttagtttctgcaaaa |
14810728 |
T |
 |
| Q |
101 |
ccaaatagtgtttaggctattgattactgctg---atagaatggcaatcttgcataatggagaccatttcctctgactaacttgaatagcttcttgaata |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14810727 |
ccaaatagtgtttaggctattgattactgctgctgatagaatggcaatcttgcaaaatggagaccatttcctctgactaacttgaatagcttcttgaata |
14810628 |
T |
 |
| Q |
198 |
gttgtaaaattgcatcgtagctttagaattgagcttaaccattgccatattgatttagcaaag |
260 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14810627 |
gttgtaaaattgcatcgtagctttagaattgagcttaaccattgccatattgatttagcaaag |
14810565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 62 - 138
Target Start/End: Original strand, 31519533 - 31519609
Alignment:
| Q |
62 |
aatcttcttatcaacaaatctcatttggtttctgcaaaaccaaatagtgtttaggctattgattactgctgatagaa |
138 |
Q |
| |
|
||||||||||||| |||| |||||||||| || || ||||| ||||||||||| | ||| || |||||||| |||| |
|
|
| T |
31519533 |
aatcttcttatcagcaaagatcatttggttcctacagaaccagatagtgtttagacaatttataactgctgaaagaa |
31519609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University