View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_29 (Length: 260)
Name: NF0254_1D_low_29
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_29 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 217; Significance: 1e-119; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 217; E-Value: 1e-119
Query Start/End: Original strand, 28 - 244
Target Start/End: Complemental strand, 16842973 - 16842757
Alignment:
| Q |
28 |
gtaatgacatcaaccaagccttgtttcttaggcataaaatacaacctccgcacaacaatgctatatgcaatcacatccaacgaatttggtgaagaagaca |
127 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842973 |
gtaatgacatcaaccaagccttgtttcttaggcataaaatacaacctccgcacaacaatgctatatgcaatcacatccaacgaatttggtgaagaagaca |
16842874 |
T |
|
| Q |
128 |
tcttcaactttagatgtaacatctctgcatctttgaagcgtcccataacactataaatatcgatccttgtacaaacaatgtgcttgttcagcttcttctc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16842873 |
tcttcaactttagatgtaacatctctgcatctttgaagcgtcccataacactataaatatcgatccttgtacaaacaatgtgcttgttcagcttcttctc |
16842774 |
T |
|
| Q |
228 |
gtcagcatcacttttca |
244 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
16842773 |
gtcagcatcacttttca |
16842757 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 139; Significance: 8e-73; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 139; E-Value: 8e-73
Query Start/End: Original strand, 74 - 244
Target Start/End: Complemental strand, 24209839 - 24209669
Alignment:
| Q |
74 |
tccgcacaacaatgctatatgcaatcacatccaacgaatttggtgaagaagacatcttcaactttagatgtaacatctctgcatctttgaagcgtcccat |
173 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| |||||||||||||||||||||| |||||| |
|
|
| T |
24209839 |
tccgcacaacaatgctatatgcaatcatatccaacgaatttggtgaagaagacttcttcaactttagatacaacatctctgcatctttgaagcatcccat |
24209740 |
T |
|
| Q |
174 |
aacactataaatatcgatccttgtacaaacaatgtgcttgttcagcttcttctcgtcagcatcacttttca |
244 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
24209739 |
gacactataaatatcgatcattgtacaaacaatgtgcttgttcagcttcttctcgtcagcattacttttca |
24209669 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 31 - 76
Target Start/End: Complemental strand, 24210236 - 24210191
Alignment:
| Q |
31 |
atgacatcaaccaagccttgtttcttaggcataaaatacaacctcc |
76 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
24210236 |
atgacatcaaccaagccttgtttcttagccataaaatacaacctcc |
24210191 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University