View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_30 (Length: 253)
Name: NF0254_1D_low_30
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_30 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 223; Significance: 1e-123; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 223; E-Value: 1e-123
Query Start/End: Original strand, 1 - 231
Target Start/End: Original strand, 34957884 - 34958114
Alignment:
| Q |
1 |
gtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaaatcagggaaactaaatgaagcggtggaacttatgaattccattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34957884 |
gtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaaattagggaaactaaatgaagcggtggaacttatgaattccattc |
34957983 |
T |
 |
| Q |
101 |
catttgaagctgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtgaaacagtgctttttcatattttttg |
200 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34957984 |
catttgaagctgatggatccgtttgaggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtgaaacagtgctttttcatattttttg |
34958083 |
T |
 |
| Q |
201 |
cttatgtgtgcttttgtatccagagccaatg |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
34958084 |
cttatgtgtgcttttgtatccagagccaatg |
34958114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 176
Target Start/End: Complemental strand, 50131752 - 50131576
Alignment:
| Q |
1 |
gtttggaatcaaaccaacacaagagcactatgcttgcatgattgatatccttggaa-atcagggaaactaaatgaagcggtggaacttatgaattccatt |
99 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| ||||||||| ||||||||||||||||||||| ||||| ||| ||||||||||| |
|
|
| T |
50131752 |
gtttggaatcaaaccaacacaagagcaccatgcttgcatgattgatctccttggaagatcagggaaactaaatgaagcagtggagcttgtgaattccatt |
50131653 |
T |
 |
| Q |
100 |
ccatttgaagctgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtga |
176 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50131652 |
ccatttgaagccgatggatccgtttggggggcgcttcttggtgctgcaagaatccacaaaaatgttgaacttggtga |
50131576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 174 - 231
Target Start/End: Complemental strand, 3922584 - 3922527
Alignment:
| Q |
174 |
tgaaacagtgctttttcatattttttgcttatgtgtgcttttgtatccagagccaatg |
231 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3922584 |
tgaagcagtgctttttcatattttttgcttatgtgtgcttttgtatccagagccaatg |
3922527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University