View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_31 (Length: 249)
Name: NF0254_1D_low_31
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_31 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 225; Significance: 1e-124; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 225; E-Value: 1e-124
Query Start/End: Original strand, 21 - 249
Target Start/End: Complemental strand, 1153560 - 1153332
Alignment:
| Q |
21 |
attgagatggaaagaaaaatttcctataacattcggcaacttaccaccaaatccatttttactaaaaatgagtgctgacaattgactacagttggttaac |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1153560 |
attgagatggaaagaaaaatttcctataacattcggcaacttaccaccaaatccatttttactaaaaatgagtgctgacaattgactacagttggttaac |
1153461 |
T |
|
| Q |
121 |
gaggaaagaaagcccaaatcatcactcccaaaattattagcgctaatatgaatcagacacttgcaattcagttaggttggaaattgaaaacggaaagatt |
220 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1153460 |
gaggaaagaaagtccaaatcatcactcccaaaattattagcgctaatatgaatcagacacttgcaattcagttaggttggaaattgaaaacggaaagatt |
1153361 |
T |
|
| Q |
221 |
ccagttaataggttatcttcgacatagaa |
249 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1153360 |
ccagttaataggttatcttcgacatagaa |
1153332 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1187 times since January 2019
Visitors: 2573