View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_32 (Length: 248)
Name: NF0254_1D_low_32
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_32 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 11 - 212
Target Start/End: Complemental strand, 3669870 - 3669671
Alignment:
| Q |
11 |
tcgtgttcttacccttccctgttctatattgnnnnnnngtcaaaagaagaagagcgttgtccaaaaaattgtcccaaattgataatactaatatcattat |
110 |
Q |
| |
|
|||||||||||| || ||||| ||||||||| ||||||||||||||| ||||| | |||||||| ||||||||||||||||| |||||||||| |
|
|
| T |
3669870 |
tcgtgttcttactctcccctgctctatattgtttttttgtcaaaagaagaagaacgttgacaaaaaaattatcccaaattgataatacaaatatcattac |
3669771 |
T |
 |
| Q |
111 |
ttcacttcaggtggaagaaatatacgagagacaaaaaatacttcttatacaattctaagatgtgatcataccagaactaatacaccgtatccaatcaaaa |
210 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3669770 |
ttcacttcaggtggaagaaatat--gagagacaaaaaatacttcttatacaattctaagatgtgatcatactagaactaatacaccgtatccaatcaaaa |
3669673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University