View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_34 (Length: 247)
Name: NF0254_1D_low_34
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_34 |
 |  |
|
[»] scaffold0041 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0041 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 179
Target Start/End: Complemental strand, 101658 - 101486
Alignment:
Q |
7 |
aaaatgaaatttcacaatgtagatgtnnnnnnncaaaccatgacatggaacgaattattgtacctcaccttcccatctgtctcccttagcaaagggaccc |
106 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
101658 |
aaaatgaaatttcacaatgtagatgtaaaaaaacaaaccatgacatggaacgaattattgtacctcaccttcccatctgtctcccttagcaaagggaccc |
101559 |
T |
 |
Q |
107 |
taactaatagcaaaagaggatgtgggttatcccatgcttcaattggaatatgtccaaatcacctgtaacttct |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
101558 |
taactaatagcaaaagaggatgtgggttatcccatgcttcaattggaatatgtccaaatcacctgtaacttct |
101486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 179
Target Start/End: Original strand, 41121491 - 41121663
Alignment:
Q |
7 |
aaaatgaaatttcacaatgtagatgtnnnnnnncaaaccatgacatggaacgaattattgtacctcaccttcccatctgtctcccttagcaaagggaccc |
106 |
Q |
|
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41121491 |
aaaatgaaatttcacaatgtagatgtaaaaaaacaaaccatgacatggaacgaattattgtacctcaccttcccatctgtctcccttagcaaagggaccc |
41121590 |
T |
 |
Q |
107 |
taactaatagcaaaagaggatgtgggttatcccatgcttcaattggaatatgtccaaatcacctgtaacttct |
179 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
41121591 |
taactaatagcaaaagaggatgtgggttatcccatgcttcaattggaatatgtccaaatcacctgtaacttct |
41121663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 60; Significance: 1e-25; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 175 - 234
Target Start/End: Original strand, 39370513 - 39370572
Alignment:
Q |
175 |
cttcttcttttttcattactagttattgccaatgcagctgattatggtccaacaccaaac |
234 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
39370513 |
cttcttcttttttcattactagttattgccaatgcagctgattatggtccaacaccaaac |
39370572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University