View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_35 (Length: 245)
Name: NF0254_1D_low_35
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 141; Significance: 5e-74; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 141; E-Value: 5e-74
Query Start/End: Original strand, 72 - 244
Target Start/End: Complemental strand, 40103158 - 40102987
Alignment:
| Q |
72 |
cttaattttctagattagtagttttattctcaccacaaattttttcttacnnnnnnnnggaaaatctcaccacaaatttccattaattgaaatacaaata |
171 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103158 |
cttaattttctagattagtagttttattctcaccacaaattttttctta-aaaaaaaaggaaaatctcaccacaaatttccattaattgaaatacaaata |
40103060 |
T |
|
| Q |
172 |
acataatgaaaatatgtgtctttcttttctagattagtgcttttaatcttaaatgagttctgccgataatagc |
244 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40103059 |
acataatgaaaatatgtgtctttcttttctagattagtgcttttaatcttaaatgagttctgccgataatagc |
40102987 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 18 - 49
Target Start/End: Complemental strand, 40103220 - 40103189
Alignment:
| Q |
18 |
gacatcagtgagcattttaatacaatgccatt |
49 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
40103220 |
gacatcagtgagcattttaatacaatgccatt |
40103189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1282 times since January 2019
Visitors: 2575