View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_37 (Length: 240)
Name: NF0254_1D_low_37
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_37 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 25 - 151
Target Start/End: Original strand, 37320614 - 37320741
Alignment:
| Q |
25 |
catcacgatgcaatatgattagccattcaacaatatatgtcgtgttttgt-ttaaagtcaaagattgaagtggtttgctttataacactatgtatttggg |
123 |
Q |
| |
|
|||||||||||||||||||| || |||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
37320614 |
catcacgatgcaatatgattggctattcaacaatatatgtcgtgttttgtgttaaagtcaaagattgaagtggtttgctttataacgctatgtatttggg |
37320713 |
T |
|
| Q |
124 |
gaagatttcgggatcaaacaattcgcta |
151 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
37320714 |
gaagatttcgggatcaaacaattcgcta |
37320741 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 7e-33
Query Start/End: Original strand, 152 - 227
Target Start/End: Original strand, 37321217 - 37321292
Alignment:
| Q |
152 |
attcataattgatgtgagactaatcattcacacactcacgcttgatgacttgaacttcaacaaaatcttaatagaa |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37321217 |
attcataattgatgtgagactaatcattcatacactcacgcttgatgacttgaacttcaacaaaatcttaatagaa |
37321292 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000001; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 78 - 126
Target Start/End: Original strand, 16756189 - 16756237
Alignment:
| Q |
78 |
aagtcaaagattgaagtggtttgctttataacactatgtatttggggaa |
126 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||| |||| ||||| |
|
|
| T |
16756189 |
aagtcaaagattgaagtggtttgatttataacacaatgcatttcgggaa |
16756237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 152 - 184
Target Start/End: Complemental strand, 32981476 - 32981444
Alignment:
| Q |
152 |
attcataattgatgtgagactaatcattcacac |
184 |
Q |
| |
|
|||||||||||||||||||||||| |||||||| |
|
|
| T |
32981476 |
attcataattgatgtgagactaattattcacac |
32981444 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.00000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 148 - 177
Target Start/End: Complemental strand, 43355244 - 43355215
Alignment:
| Q |
148 |
gctaattcataattgatgtgagactaatca |
177 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43355244 |
gctaattcataattgatgtgagactaatca |
43355215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 992 times since January 2019
Visitors: 2571