View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_38 (Length: 239)
Name: NF0254_1D_low_38
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_38 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 1 - 208
Target Start/End: Original strand, 43410796 - 43411010
Alignment:
| Q |
1 |
tgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatcatctcacacacgtaccattagactctctcttttt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43410796 |
tgaaggagaatgggttgtgttatcatgtgatgctgatcttgaagaatgtaaagacttgcacacatcatctcacacacgtaccattagactctctcttttt |
43410895 |
T |
 |
| Q |
101 |
caagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctc----ctagctagcttacaacttc---tcatctgaatgt |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
43410896 |
caagcttcccctctcaatcttccaaacactttccgcaacagcagcagcagcagtccatcctcctagctagctagcttacaacttctgatcatctgaatgt |
43410995 |
T |
 |
| Q |
194 |
gttgtgtctgtctgt |
208 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
43410996 |
gttgtgtctgtctgt |
43411010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University