View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_39 (Length: 235)
Name: NF0254_1D_low_39
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_39 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 14 - 232
Target Start/End: Complemental strand, 27053317 - 27053099
Alignment:
| Q |
14 |
tactaagtatggtcacttcattcttttaatacattattagtcaatttcgatgtttctttcttcttcttcattttagatcattctgcatgccatgcgctca |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053317 |
tactaagtatggtcacttcattcttttaatacattattagtcaatttcgatgtttctttcttcttcttcattttagatcattctgcatgccatgcgctca |
27053218 |
T |
|
| Q |
114 |
tgaagtcaataacaaaggtattgacatcacaaatgaaacagnnnnnnnntttgtatgctactcaaacattcatttaaattatttaagaagtttaatggca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27053217 |
tgaagtcaataacaaaggtattgacatcacaaatgaaacagaaaaaaaatttgtatgctactcaaacattcatttaaattatttaagaagtttaatggca |
27053118 |
T |
|
| Q |
214 |
acattaataagggtaatga |
232 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
27053117 |
acattaataagggtaatga |
27053099 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1008 times since January 2019
Visitors: 2571