View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_41 (Length: 232)
Name: NF0254_1D_low_41
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_41 |
 | |
|
| [»] chr4 (1 HSPs) |
| |
|
Alignment Details
Target: chr4 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 21 - 232
Target Start/End: Original strand, 17353895 - 17354106
Alignment:
| Q |
21 |
tttacatgagaacagaatctccgattaaacacgaacgaccctgattacgcccttgttctgtagttcaattaagatgataaatcgatttgtcttgcaaagc |
120 |
Q |
| |
|
|||||| ||||||||| |||| |||| ||| |||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17353895 |
tttacacgagaacagagtctcttattacacaggaacgaccctaattacgtccttgttctgtagttcaattaagatgataaatcgatttgtcttgcaaagc |
17353994 |
T |
|
| Q |
121 |
atatgatttccttatggtgaggccatatgattgactttggtgctgttgcgtttaggcaatccagaggatcgtttgatttagacaattttattgatatcct |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17353995 |
atatgatttccttctggtgaggccatatgattgatgttggtgttgttgtgtttaggcaatccagaggatcgtttgatttagacaattttattgatatcct |
17354094 |
T |
|
| Q |
221 |
tttgtgctgatg |
232 |
Q |
| |
|
|||||||||||| |
|
|
| T |
17354095 |
tttgtgctgatg |
17354106 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University