View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_43 (Length: 229)
Name: NF0254_1D_low_43
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_43 |
 | |
|
| [»] scaffold0037 (1 HSPs) |
| | |
|
Alignment Details
Target: chr7 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 23 - 212
Target Start/End: Complemental strand, 8059315 - 8059130
Alignment:
| Q |
23 |
gatatgaatgacaaattggatttatgattgtgtgagctacatacatatacgagggataattgcaaccataggaatccaggatatgactgtcatgagacaa |
122 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||| || |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8059315 |
gatatgaatgacaaattggatttatgattgtgtgatctacata----taggaggaataattgcaaccataggaatccaggatatgactgtcatgagacaa |
8059220 |
T |
|
| Q |
123 |
agttgattcaagatatgtcttattcacaggcttgtaaggagaagaaaatgaaatatcaaattcacttcaatttctcttagacagatgcat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
8059219 |
tgttgattcaagatatgtcttattcacaggcttgtaaagagaagaaaatgaaatatcaaattcacttcaatgtctcttagacagatgcat |
8059130 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0037 (Bit Score: 49; Significance: 4e-19; HSPs: 1)
Name: scaffold0037
Description:
Target: scaffold0037; HSP #1
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 113 - 193
Target Start/End: Original strand, 34767 - 34847
Alignment:
| Q |
113 |
catgagacaaagttgattcaagatatgtcttattcacaggcttgtaaggagaagaaaatgaaatatcaaattcacttcaat |
193 |
Q |
| |
|
|||| ||||| ||||||||||||||||||| ||| | | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34767 |
catgggacaacgttgattcaagatatgtctcatttatcgtcttgtaaagagaagaaaatgaaatatcaaattcacttcaat |
34847 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 48; Significance: 1e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 48; E-Value: 1e-18
Query Start/End: Original strand, 118 - 193
Target Start/End: Original strand, 10428722 - 10428797
Alignment:
| Q |
118 |
gacaaagttgattcaagatatgtcttattcacaggcttgtaaggagaagaaaatgaaatatcaaattcacttcaat |
193 |
Q |
| |
|
||||| ||||||||||||||||||| ||| | | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10428722 |
gacaacgttgattcaagatatgtctcatttatcgtcttgtaaagagaagaaaatgaaatatcaaattcacttcaat |
10428797 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1309 times since January 2019
Visitors: 2577