View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_44 (Length: 227)
Name: NF0254_1D_low_44
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_44 |
 | |
|
| [»] scaffold0045 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 35 - 162
Target Start/End: Complemental strand, 27494505 - 27494378
Alignment:
| Q |
35 |
ctcaacaaacgacaacatgtggcgattcaaagggatctcccacagaatctaccagaccaaagatgtttcatcatcctttcttgcaatgggacacacttta |
134 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27494505 |
ctcaacaaacgacaacatgtggcgattcgaagggatctcccacaaaatctaccagaccaaagatgtttcatcatcctttcttgcaatgggacacacttta |
27494406 |
T |
|
| Q |
135 |
tgggagaagctatatgcaactcatgttt |
162 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27494405 |
tgggagaagctatatgcaactcatgttt |
27494378 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 35 - 217
Target Start/End: Complemental strand, 26809891 - 26809709
Alignment:
| Q |
35 |
ctcaacaaacgacaacatgtggcgattcaaagggatctcccacagaatctaccagaccaaagatgtttcatcatcctttcttgcaatgggacacacttta |
134 |
Q |
| |
|
||||| |||| ||||||| ||||||| | ||| |||||||| | || ||||||||| || |||||||| ||||| || ||||||||||||| |||||| |
|
|
| T |
26809891 |
ctcaagaaacaacaacatatggcgatccgaagatatctcccataaaagttaccagacccaaaatgtttcaacatcccttgttgcaatgggacatacttta |
26809792 |
T |
|
| Q |
135 |
tgggagaagctatatgcaactcatgtttaggtataaatggcatgtccttctctatcctgaacaagtttgaagattttatacca |
217 |
Q |
| |
|
|||||||||||||||| ||| | ||| ||||||||| |||||| ||| || |||||||||||||||| || |||||||| |
|
|
| T |
26809791 |
tgggagaagctatatgtgacttaggttcgagtataaatgttatgtccctctttaccctgaacaagtttgaaaatcttatacca |
26809709 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0045 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0045
Description:
Target: scaffold0045; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 39
Target Start/End: Complemental strand, 8719 - 8689
Alignment:
| Q |
9 |
gaaatgaaatgagcaagccatgatgtctcaa |
39 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
8719 |
gaaatgaaatgagcaagccatgatgtctcaa |
8689 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University