View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_45 (Length: 226)
Name: NF0254_1D_low_45
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_45 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 179; Significance: 9e-97; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 33 - 219
Target Start/End: Original strand, 38050933 - 38051119
Alignment:
| Q |
33 |
taaagtaatttcttcttcatataatcaaatgttaaaatgtgaaaaagaatgaatcgtgtattttgtatatttgtgtatttaatgggagctagctaattga |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38050933 |
taaagtaatttcttcttcatataatcaaatgttaaaatgtgaaaaagaatgaatcgtgtattttgtatatttgtgtatttaatgggagctagctaattga |
38051032 |
T |
 |
| Q |
133 |
aaattcccaaaagtaccgttttcccttcaatgaacataacacggttttgcacttcctcctcgcttcaaatattgttgtcagaagaat |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38051033 |
aaattcccaaaagtaccgttttcccttcaatcaacataacaccgttttgcacttcctcctcgcttcaaatattgttgtcagaagaat |
38051119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 33 - 75
Target Start/End: Original strand, 38055784 - 38055826
Alignment:
| Q |
33 |
taaagtaatttcttcttcatataatcaaatgttaaaatgtgaa |
75 |
Q |
| |
|
||||||||||||||||||||| |||| || ||||||||||||| |
|
|
| T |
38055784 |
taaagtaatttcttcttcatacaatcgaaggttaaaatgtgaa |
38055826 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University