View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_46 (Length: 225)
Name: NF0254_1D_low_46
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_46 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 12 - 214
Target Start/End: Complemental strand, 15938700 - 15938498
Alignment:
Q |
12 |
agtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctatgtatttg |
111 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
15938700 |
agtgagagaaagatttgaatattttttgttgttggagtgttcatgtcaaagtgaaccgacaatttatgtggtacaaattaaactgaatgctatgtatttg |
15938601 |
T |
 |
Q |
112 |
catttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacagagactaaa |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
T |
15938600 |
catttctttcaccttctttcaaaattcataacacacaaactttcgttttcttctaacaattacattatgtcaaagtgcaccgacacaaacagagattaaa |
15938501 |
T |
 |
Q |
212 |
cat |
214 |
Q |
|
|
||| |
|
|
T |
15938500 |
cat |
15938498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1285 times since January 2019
Visitors: 2575