View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_49 (Length: 222)
Name: NF0254_1D_low_49
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_49 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 34 - 211
Target Start/End: Complemental strand, 53961328 - 53961151
Alignment:
Q |
34 |
attttagaatatgtacaatatgacatagaaatactcaattatctttacacgctcttttctagatgatgaaaagctaatatttatcgtcattatttaacaa |
133 |
Q |
|
|
||||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
53961328 |
attttagaatatgtacactatgacataaaaatactcaattatctttacacgctcttttctagatgatgaaaagctaatatttatcgtcattatttaacaa |
53961229 |
T |
 |
Q |
134 |
gtatgcctgctaatcaagcatttgttattctaatgaaaaatgcttaatcataatgatacttagctacctttcattcat |
211 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |
|
|
T |
53961228 |
gtatgcctgctaatcaagcatttgttattctaatgaaaaatgcttaatcataatgatacttagctgcctttcattcat |
53961151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University