View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_51 (Length: 212)
Name: NF0254_1D_low_51
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_1D_low_51 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 5 - 212
Target Start/End: Original strand, 28862191 - 28862398
Alignment:
| Q |
5 |
attattctgacttaattgcagaatttgatcaatacaatactagtgaaattgcaaatatggatcgaccattgggtcgatgtgcaacactgtctgcagcatt |
104 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28862191 |
attattctgacttaattgcagaatttgatcaatacaatactagtgaaattgcaaatatggatcgaccattgggtcgatgtgcaacactgtctgcagcatt |
28862290 |
T |
 |
| Q |
105 |
cttttccgcattgaatataactgaggagaactcttcttctaaccaggtggacaatcccaatgataagtcagatcctcttctgcaaaactcagttccaatg |
204 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
28862291 |
cttttccgcattgaataaaactgaggagaactcttcttctaaccaggtggacaatcccaatgataaggcagattctcttctgcaaaactcagttccaatg |
28862390 |
T |
 |
| Q |
205 |
attgatga |
212 |
Q |
| |
|
||| |||| |
|
|
| T |
28862391 |
attaatga |
28862398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University