View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_1D_low_54 (Length: 207)
Name: NF0254_1D_low_54
Description: NF0254_1D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_1D_low_54 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 188; Significance: 1e-102; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 6 - 197
Target Start/End: Complemental strand, 32261499 - 32261308
Alignment:
Q |
6 |
atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta |
105 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
32261499 |
atgaatcacaaagacacataagggactttcttgaattgggttgcaaatttccactagggcagtcatgccacgaacgtttccttcactatgtaaacaagta |
32261400 |
T |
 |
Q |
106 |
acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaagactcgaggacgatg |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
T |
32261399 |
acaatgcgaaactctgaatttcttggagtgttttggattgttctcatttcttcatcaaatatgcttgatgaacttaatactcgaggacgatg |
32261308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University