View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_high_13 (Length: 263)
Name: NF0254_2D_high_13
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_2D_high_13 |
 |  |
|
[»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 46 - 263
Target Start/End: Complemental strand, 32815696 - 32815482
Alignment:
Q |
46 |
agcatcacaccatatacatcatgataaataaggggcctcgccccacctacgataaccacactcatacttactaattactcacttcattattcgccaacac |
145 |
Q |
|
|
|||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
T |
32815696 |
agcatcacaccatatacatcattataaataaggggccttgccccacctacgataaccacactcatacttactaattactcacttcactattcgccaacac |
32815597 |
T |
 |
Q |
146 |
ccaattttacttgtgcattagtgtcttttgccccttccccctcctgcattttagagaaggagcttacgatcagtcacactaattatactcatttgtgaag |
245 |
Q |
|
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||| ||||||||| |||||||| |
|
|
T |
32815596 |
ccaattttacttgtgcattagtgtcttttgcccc-tccccctcctgcattttagagaaggagcttacgaccagtcacact--ttatactcacttgtgaag |
32815500 |
T |
 |
Q |
246 |
gaaggacactctcccctc |
263 |
Q |
|
|
|||||||||||||||||| |
|
|
T |
32815499 |
gaaggacactctcccctc |
32815482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University