View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_high_15 (Length: 242)
Name: NF0254_2D_high_15
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_2D_high_15 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 19 - 223
Target Start/End: Complemental strand, 45349247 - 45349043
Alignment:
Q |
19 |
acatggaagcctaatagggccatcattttgaaacccatattcaacttctgcttcatccagtaacatcttgaattttgggtgattaacaaacttggttttc |
118 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45349247 |
acatggaagcctaatagggccatcattttgaaacccatattcaacttctgcttcatccagtaacatcttgaattttgggtgattaacaaacttggttttc |
45349148 |
T |
 |
Q |
119 |
acaacaaacctttgactttgtagtccaacataaactgtaaaacaaccattgggaatttttacaattcgacccttcgcattttctgaaaatgattttgaac |
218 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
45349147 |
acaacaaacctttgactttgtagtccaacataaactgtaaaacaaccattgggaatttttacaattcgacccttcgcattttctgaaaatgattttgaac |
45349048 |
T |
 |
Q |
219 |
tactc |
223 |
Q |
|
|
||||| |
|
|
T |
45349047 |
tactc |
45349043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University