View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_high_18 (Length: 219)
Name: NF0254_2D_high_18
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_high_18 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 184; Significance: 1e-100; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 184; E-Value: 1e-100
Query Start/End: Original strand, 1 - 219
Target Start/End: Original strand, 45348577 - 45348796
Alignment:
| Q |
1 |
ttttgtgcgttgacactacccatagacgaagaccaaagaatgttgtttccttcattttttatgtataaatccattacattctctttagaaatacctcatt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45348577 |
ttttgtgcgttgacactacccatagacgaagaccaaagaatgtt---tacttcattttttatgtataaatccattacattctctttagaaatacctcatt |
45348673 |
T |
 |
| Q |
101 |
agatgacctatctctcttccatttctttattaaaagccagcacaactcaatttttcaggtatactata----tagtattcaattattcatgcatgcttcc |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45348674 |
agatgacctatctctcttccatttctttattgaaagccagcacaactcaatttttcaggtatactatataagtagtattcaattattcatgcatgcttcc |
45348773 |
T |
 |
| Q |
197 |
catgcattttcaattatttattt |
219 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
45348774 |
catgcattttcaattatttattt |
45348796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University