View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_high_19 (Length: 216)
Name: NF0254_2D_high_19
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_2D_high_19 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 56492429 - 56492219
Alignment:
Q |
1 |
ctttgttgctgctgtttcgcgccacaaccccacctttcctaatcctcccattactatgactatgatgatcatcatcatcaattcttgaacagtatcttct |
100 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||| |
|
|
T |
56492429 |
ctttgttgctgctgtttcgcaccacaaccccacctttcctaatcctcccattactatgactatgatgatgatcatcatcaattcttgaacagtattttct |
56492330 |
T |
 |
Q |
101 |
cactctcattacattacaaggaaacacaccaacacttacacccctcatcgcattcatggcatggcatagcatggaaaccaaacaccaaatcaaatattat |
200 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
56492329 |
cactctcattacattacaaggaaacacaccaacacttacacccctcatcgcattcatggcatggcatagcatggaaaccaaacaccaaatcaaatattat |
56492230 |
T |
 |
Q |
201 |
gttgttgtttc |
211 |
Q |
|
|
||||||||||| |
|
|
T |
56492229 |
gttgttgtttc |
56492219 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University