View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_19 (Length: 308)
Name: NF0254_2D_low_19
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_2D_low_19 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 158; Significance: 4e-84; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 158; E-Value: 4e-84
Query Start/End: Original strand, 1 - 170
Target Start/End: Original strand, 11681085 - 11681253
Alignment:
Q |
1 |
aaaaggctattggcttatttcgcatgcggctatatgaaaggcgcgaaatggaatgatttttcttatgataaggggatagatgttgaggaattgatggaag |
100 |
Q |
|
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681085 |
aaaaggctattggcttatttggcatgcggctatatgaaaggcgcgaaatggaatgattttt-ttatgataaggggatagatgttgaggaattgatggaag |
11681183 |
T |
 |
Q |
101 |
aggtcaaagtcctttcctggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
170 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
11681184 |
aggtcaaagtcctttcctggaaatggagttgtctaggttgaagtcttctctatgtatgttctacgagatg |
11681253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 97; E-Value: 1e-47
Query Start/End: Original strand, 181 - 293
Target Start/End: Original strand, 11681305 - 11681417
Alignment:
Q |
181 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgagatgctgcggtttgtgctggttttgctggggttttcactgt |
280 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| ||||||||||| |||| ||||| |
|
|
T |
11681305 |
agtcgtagctttgtgttttggttcagctgtctctgaagggtgcatggaccttttgctgtgatgctgcggtttgtgctagttttgctgggtttttgactgt |
11681404 |
T |
 |
Q |
281 |
ttgtctttgatgt |
293 |
Q |
|
|
||||||||||||| |
|
|
T |
11681405 |
ttgtctttgatgt |
11681417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University