View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_26 (Length: 275)
Name: NF0254_2D_low_26
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_2D_low_26 |
 |  |
|
[»] scaffold0005 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 8 - 254
Target Start/End: Complemental strand, 16919678 - 16919432
Alignment:
Q |
8 |
tttggtgttggcttgcttcaattctcaaccaatctcttcatttttcagcgttggaagaaatttggggccttagtggaagaggttggtctcctcaatgtag |
107 |
Q |
|
|
||||||||||||| ||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| || ||||| |
|
|
T |
16919678 |
tttggtgttggctggcttcaaatctcaaccaatctcttcatttttcagctttggaagaaatttggggccttagtgaaagaggttggtctccacagtgtag |
16919579 |
T |
 |
Q |
108 |
attaacaattattgctgctatcgttaacatcatttctgctatttggtatgctaggaatcaatgcagattccaaaataggaggattcattggaagagtgct |
207 |
Q |
|
|
||||||||||||||||||| | |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
16919578 |
attaacaattattgctgctgttgttaacattatttctgctatttggtacgctaggaatcaatgcagattccaaaataggaggattcattggaagagtgct |
16919479 |
T |
 |
Q |
208 |
atatctcatatcactgtaaatgtttctctgtctgctagcaactctaa |
254 |
Q |
|
|
|||||||||||||||||||||||||| || ||||||||||||||||| |
|
|
T |
16919478 |
atatctcatatcactgtaaatgtttccctatctgctagcaactctaa |
16919432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 8 - 103
Target Start/End: Complemental strand, 14628039 - 14627944
Alignment:
Q |
8 |
tttggtgttggcttgcttcaattctcaaccaatctcttcatttttcagcgttggaagaaatttggggccttagtggaagaggttggtctcctcaat |
103 |
Q |
|
|
||||||||||| | ||||| |||||||||||||| |||||||| | ||| || || ||||||||| | | |||| ||||||||||| ||||||| |
|
|
T |
14628039 |
tttggtgttggttggcttctattctcaaccaatcccttcatttcttagctttagaggaaatttggagtttgagtgcgagaggttggtcacctcaat |
14627944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 242
Target Start/End: Complemental strand, 14627905 - 14627805
Alignment:
Q |
142 |
tctgctatttggtatgctaggaatcaatgcagattccaaaataggaggattcattggaagagtgctatatctcatatcactgtaaatgtttctctgtctg |
241 |
Q |
|
|
|||||||||||| ||||||| ||| | |||||| |||| |||| |||||||||| | |||| |||||||| |||| ||| ||||||||| |||||| |
|
|
T |
14627905 |
tctgctatttggaatgctagaaatacttatagattcaaaaacaggaagattcattgggaaagtgtcatatctcaaatcattgttaatgtttctttgtctg |
14627806 |
T |
 |
Q |
242 |
c |
242 |
Q |
|
|
| |
|
|
T |
14627805 |
c |
14627805 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 32; Significance: 0.000000006; HSPs: 2)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 8 - 103
Target Start/End: Original strand, 189344 - 189439
Alignment:
Q |
8 |
tttggtgttggcttgcttcaattctcaaccaatctcttcatttttcagcgttggaagaaatttggggccttagtggaagaggttggtctcctcaat |
103 |
Q |
|
|
||||||||||| | ||||| |||||||||||||| |||||||| | ||| || || ||||||||| | | |||| ||||||||||| ||||||| |
|
|
T |
189344 |
tttggtgttggttggcttctattctcaaccaatcccttcatttcttagctttagaggaaatttggagtttgagtgcgagaggttggtcacctcaat |
189439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 242
Target Start/End: Original strand, 189478 - 189578
Alignment:
Q |
142 |
tctgctatttggtatgctaggaatcaatgcagattccaaaataggaggattcattggaagagtgctatatctcatatcactgtaaatgtttctctgtctg |
241 |
Q |
|
|
|||||||||||| ||||||| ||| | |||||| |||| |||| |||||||||| | |||| |||||||| |||| ||| ||||||||| |||||| |
|
|
T |
189478 |
tctgctatttggaatgctagaaatacttatagattcaaaaacaggaagattcattgggaaagtgtcatatctcaaatcattgttaatgtttctttgtctg |
189577 |
T |
 |
Q |
242 |
c |
242 |
Q |
|
|
| |
|
|
T |
189578 |
c |
189578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 798 times since January 2019
Visitors: 2568