View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0254_2D_low_28 (Length: 266)

Name: NF0254_2D_low_28
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0254_2D_low_28
NF0254_2D_low_28
[»] chr2 (3 HSPs)
chr2 (1-234)||(36953036-36953267)
chr2 (166-214)||(36947890-36947938)
chr2 (210-248)||(36947443-36947481)


Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 36953267 - 36953036
Alignment:
1 aagtttatgtatgcatagatagatctggttgattcacttagataaatcatttaacccaaaatccttacccatagcaatgattttatgatcttttctctac 100  Q
    ||||||||| ||||||||||| |||| |||||||||||||| ||||||||| | |||||||||||||||||   ||||||||||||||||||| |||||     
36953267 aagtttatgcatgcatagataaatctagttgattcacttagctaaatcattca-cccaaaatccttacccaa--caatgattttatgatcttt-ctctat 36953172  T
101 tattctttgcccactttccaacaacttagaactgcaacaatatatgtctacactagcttcaaacgattcacttgcactat--ttttaaaggattcaaaca 198  Q
    |||||||| ||||||||||||||||||| |||||||| ||| ||||| |||||||| |||||| ||||||||||||||||  ||||||||||||||||||    
36953171 tattcttttcccactttccaacaacttaaaactgcaataatttatgtgtacactagtttcaaatgattcacttgcactattgttttaaaggattcaaaca 36953072  T
199 tacaggtttaactatttagtagtattttgataattt 234  Q
    | |||||||||||||||||||||| ||||| |||||    
36953071 ttcaggtttaactatttagtagtactttgagaattt 36953036  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 36947938 - 36947890
Alignment:
166 attcacttgcactatttttaaaggattcaaacatacaggtttaactatt 214  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||    
36947938 attcacttgcactatttttaaaggattcaaacatacaggtttaactatt 36947890  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 36947481 - 36947443
Alignment:
210 ctatttagtagtattttgataattttctcctcgcctctt 248  Q
    |||||||||||||||||||||||||||||||||||||||    
36947481 ctatttagtagtattttgataattttctcctcgcctctt 36947443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University