View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_29 (Length: 266)
Name: NF0254_2D_low_29
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_low_29 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 2e-67; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 234
Target Start/End: Complemental strand, 36953267 - 36953036
Alignment:
| Q |
1 |
aagtttatgtatgcatagatagatctggttgattcacttagataaatcatttaacccaaaatccttacccatagcaatgattttatgatcttttctctac |
100 |
Q |
| |
|
||||||||| ||||||||||| |||| |||||||||||||| ||||||||| | ||||||||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
36953267 |
aagtttatgcatgcatagataaatctagttgattcacttagctaaatcattca-cccaaaatccttacccaa--caatgattttatgatcttt-ctctat |
36953172 |
T |
 |
| Q |
101 |
tattctttgcccactttccaacaacttagaactgcaacaatatatgtctacactagcttcaaacgattcacttgcactat--ttttaaaggattcaaaca |
198 |
Q |
| |
|
|||||||| ||||||||||||||||||| |||||||| ||| ||||| |||||||| |||||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
36953171 |
tattcttttcccactttccaacaacttaaaactgcaataatttatgtgtacactagtttcaaatgattcacttgcactattgttttaaaggattcaaaca |
36953072 |
T |
 |
| Q |
199 |
tacaggtttaactatttagtagtattttgataattt |
234 |
Q |
| |
|
| |||||||||||||||||||||| ||||| ||||| |
|
|
| T |
36953071 |
ttcaggtttaactatttagtagtactttgagaattt |
36953036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 166 - 214
Target Start/End: Complemental strand, 36947938 - 36947890
Alignment:
| Q |
166 |
attcacttgcactatttttaaaggattcaaacatacaggtttaactatt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947938 |
attcacttgcactatttttaaaggattcaaacatacaggtttaactatt |
36947890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 210 - 248
Target Start/End: Complemental strand, 36947481 - 36947443
Alignment:
| Q |
210 |
ctatttagtagtattttgataattttctcctcgcctctt |
248 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36947481 |
ctatttagtagtattttgataattttctcctcgcctctt |
36947443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University