View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_34 (Length: 262)
Name: NF0254_2D_low_34
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_low_34 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 18460178 - 18460431
Alignment:
| Q |
1 |
taatctaaatctatcggttaagattaattgttctcatctctacaaataaccaannnnnnnnnnnnnnnnnnnnnnnnttgcttcccaatttcaaagaata |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
18460178 |
taatctaaatctatcggttaagattaattgttctcatctctacaaataaccaagtgtgtgtatatgtgtgtgcgtgtttgcttcccaatttcaaagaata |
18460277 |
T |
|
| Q |
101 |
atatgaacctgctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagcacttaatgaaggcccagccctgt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18460278 |
atatgaacctgctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagcacttaatgaaggcccagccctgt |
18460377 |
T |
|
| Q |
201 |
aagccatgaaggaagtcaggaaaatcaacaaagatttcaaaatccattgatgtc |
254 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||| |||||||||| |
|
|
| T |
18460378 |
aagccatgaaggaagtcaggaacatcaacaaagatttcaaaattcattgatgtc |
18460431 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 48; Significance: 2e-18; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 202
Target Start/End: Original strand, 26844851 - 26844942
Alignment:
| Q |
111 |
gctccattattcctttgtacataatcatcagtgccctctttccataagcactgtcgtaattataagcacttaatgaaggcccagccctgtaa |
202 |
Q |
| |
|
|||||| |||||| ||||||| || ||||||||| ||||| ||||||||||| || |||||||| |||||||| |||||||| ||||||||| |
|
|
| T |
26844851 |
gctccagtattccattgtacaaaagcatcagtgctctcttcccataagcactatcataattatatgcacttaacgaaggccctgccctgtaa |
26844942 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1200 times since January 2019
Visitors: 2573