View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_40 (Length: 223)
Name: NF0254_2D_low_40
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_low_40 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 1e-74; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 1e-74
Query Start/End: Original strand, 51 - 204
Target Start/End: Original strand, 36198416 - 36198569
Alignment:
| Q |
51 |
ttgaatatgctgctggtcgtaatcacgtcacatctcttagcattcccaatctcgcaaaatgggttaaccttgttgttcaacgcaaagttaagcatcttca |
150 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
36198416 |
ttgaatatgctgctagtcgtaatcacgtcacatctcttagcattcccaatctcgcaaaatgggttaaccttgttgttcaacgcaaagttaagaatcttca |
36198515 |
T |
|
| Q |
151 |
tctccttctcaatttgctcaatgatccaattccccccggttttctactgcccaa |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36198516 |
tctccttctcaatttgctcaatgatccaattccccccggttttctactccccaa |
36198569 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 1 - 57
Target Start/End: Complemental strand, 36198391 - 36198335
Alignment:
| Q |
1 |
aatgattaccagtggcttctcgcgagagcataaaatagtcgacaaactgattgaata |
57 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
36198391 |
aatgattaccagtggcttctcgcgagagcataaaatagtcgacgaactgattgaata |
36198335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 36; Significance: 0.00000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 5 - 56
Target Start/End: Original strand, 694640 - 694691
Alignment:
| Q |
5 |
attaccagtggcttctcgcgagagcataaaatagtcgacaaactgattgaat |
56 |
Q |
| |
|
|||||||| |||||||||||||||||||| | ||| |||||||||||||||| |
|
|
| T |
694640 |
attaccagcggcttctcgcgagagcataacagagtagacaaactgattgaat |
694691 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 93 - 153
Target Start/End: Complemental strand, 1012931 - 1012871
Alignment:
| Q |
93 |
ttcccaatctcgcaaaatgggttaaccttgttgttcaacgcaaagttaagcatcttcatct |
153 |
Q |
| |
|
|||||||| || | |||||| | ||||||||||||||||||||| | || ||||||||||| |
|
|
| T |
1012931 |
ttcccaatgtcactaaatggatcaaccttgttgttcaacgcaaactcaaccatcttcatct |
1012871 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1315 times since January 2019
Visitors: 2577