View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_42 (Length: 222)
Name: NF0254_2D_low_42
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_low_42 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 16 - 215
Target Start/End: Original strand, 49133128 - 49133327
Alignment:
| Q |
16 |
gatggtggtcatcatgaaggaagaggcatgcctgagaatgttgatggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatg |
115 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133128 |
gatggtggtcatcatgaaggaaaaggcatgcctgagaatattgatggtcgaattgcttgatttataagaatatgttatcctgtcgaagaaatagaacatg |
49133227 |
T |
|
| Q |
116 |
ttctgtaacattttatcattgttcttcaccagatttagctgtgtgtctatccattactttacttgatccaaagttggtgaacaattttcatcattgatgt |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49133228 |
ttctgtaacattttatcattgttcttcaccagatttagctgtgtgtctatccattactttacttgatccaaagttggtgaacaattttcatcattgatgt |
49133327 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University