View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_2D_low_50 (Length: 206)
Name: NF0254_2D_low_50
Description: NF0254_2D
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_2D_low_50 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 193
Target Start/End: Complemental strand, 29421654 - 29421471
Alignment:
| Q |
1 |
aggttcctgtgacaccatgttattctattcttgctgaataatgaccaaagtcactattgtaattatagaaattatagaaatatgggatctaattttaaaa |
100 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
29421654 |
aggttcctttgacaccttgttattctattcttgctgaataatgaccaaagtcactattgtaattatagaaat---------atgggatctaattttaaaa |
29421564 |
T |
 |
| Q |
101 |
taatccaggggttggtttcataaaaaacaattatgatttgataatttgtgcaatatctgtaattactggataaccatgcaaactattgatgtc |
193 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
29421563 |
taatccaggggttggtttcataaaaaacaattatgatttgataatttgtggaatatctgtaattactggataaccatgcaaactattaatgtc |
29421471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University