View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_high_20 (Length: 201)
Name: NF0254_high_20
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_high_20 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 94 - 201
Target Start/End: Complemental strand, 41276829 - 41276721
Alignment:
| Q |
94 |
atcactaaaatgagaggggcaaaatttaaagattacaaagtcatcagaaatttctacaaaataggatctatt-ccataaccatgtaaactcaacttcatg |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
41276829 |
atcactaaaatgagaggggcaaaatttaaagattacaaagtcatcagaaatttctacaaaataggatctattcccataaccatgtaaactcaacttcatg |
41276730 |
T |
 |
| Q |
193 |
atttaacta |
201 |
Q |
| |
|
||||||||| |
|
|
| T |
41276729 |
atttaacta |
41276721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University