View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_14 (Length: 317)
Name: NF0254_low_14
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_14 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 3e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 3e-54
Query Start/End: Original strand, 105 - 231
Target Start/End: Complemental strand, 37320741 - 37320614
Alignment:
| Q |
105 |
tagcgaattgtttgatcccgaaatcttccccaaatacatagtgttataaagcaaaccacttcaatctttgactttaa-acaaaacacgacatatattgtt |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
37320741 |
tagcgaattgtttgatcccgaaatcttccccaaatacatagcgttataaagcaaaccacttcaatctttgactttaacacaaaacacgacatatattgtt |
37320642 |
T |
|
| Q |
204 |
gaatggctaatcatattgcatcgtgatg |
231 |
Q |
| |
|
|||| || |||||||||||||||||||| |
|
|
| T |
37320641 |
gaatagccaatcatattgcatcgtgatg |
37320614 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 29 - 104
Target Start/End: Complemental strand, 37321292 - 37321217
Alignment:
| Q |
29 |
ttctattaagattttgttgaagttcaagtcatcaagcgtgagtgtgtgaatgattagtctcacatcaattatgaat |
104 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
37321292 |
ttctattaagattttgttgaagttcaagtcatcaagcgtgagtgtatgaatgattagtctcacatcaattatgaat |
37321217 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 130 - 178
Target Start/End: Complemental strand, 16756237 - 16756189
Alignment:
| Q |
130 |
ttccccaaatacatagtgttataaagcaaaccacttcaatctttgactt |
178 |
Q |
| |
|
||||| |||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
16756237 |
ttcccgaaatgcattgtgttataaatcaaaccacttcaatctttgactt |
16756189 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 72 - 104
Target Start/End: Original strand, 32981444 - 32981476
Alignment:
| Q |
72 |
gtgtgaatgattagtctcacatcaattatgaat |
104 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
32981444 |
gtgtgaataattagtctcacatcaattatgaat |
32981476 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 79 - 108
Target Start/End: Original strand, 43355215 - 43355244
Alignment:
| Q |
79 |
tgattagtctcacatcaattatgaattagc |
108 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
43355215 |
tgattagtctcacatcaattatgaattagc |
43355244 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University