View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0254_low_17 (Length: 293)

Name: NF0254_low_17
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0254_low_17
NF0254_low_17
[»] chr8 (2 HSPs)
chr8 (128-240)||(32180379-32180491)
chr8 (72-114)||(32180318-32180360)


Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 128 - 240
Target Start/End: Original strand, 32180379 - 32180491
Alignment:
128 aataaatcatcaatttaatttctaaactatcactatctcacaaatttcgtaaaaatatgtaataagtaatccataaactatttttaattcatgaaaattc 227  Q
    ||||||||||||||||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32180379 aataaatcatcaatttaatctctaaattatcactatctcacaaatttcgtaaaaatatgtaataagtaatccataaactatttttaattcatgaaaattc 32180478  T
228 tgtctaaccctat 240  Q
    |||||||||||||    
32180479 tgtctaaccctat 32180491  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 72 - 114
Target Start/End: Original strand, 32180318 - 32180360
Alignment:
72 aatatgttgtccatttcttgtgttttagtaacatttctaacat 114  Q
    ||||||| |||||||||||||||||||||||||||||||||||    
32180318 aatatgtagtccatttcttgtgttttagtaacatttctaacat 32180360  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University