View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_17 (Length: 293)
Name: NF0254_low_17
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_17 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 128 - 240
Target Start/End: Original strand, 32180379 - 32180491
Alignment:
| Q |
128 |
aataaatcatcaatttaatttctaaactatcactatctcacaaatttcgtaaaaatatgtaataagtaatccataaactatttttaattcatgaaaattc |
227 |
Q |
| |
|
||||||||||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180379 |
aataaatcatcaatttaatctctaaattatcactatctcacaaatttcgtaaaaatatgtaataagtaatccataaactatttttaattcatgaaaattc |
32180478 |
T |
 |
| Q |
228 |
tgtctaaccctat |
240 |
Q |
| |
|
||||||||||||| |
|
|
| T |
32180479 |
tgtctaaccctat |
32180491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 72 - 114
Target Start/End: Original strand, 32180318 - 32180360
Alignment:
| Q |
72 |
aatatgttgtccatttcttgtgttttagtaacatttctaacat |
114 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
32180318 |
aatatgtagtccatttcttgtgttttagtaacatttctaacat |
32180360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University