View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_20 (Length: 273)
Name: NF0254_low_20
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_20 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 73 - 245
Target Start/End: Complemental strand, 45363087 - 45362915
Alignment:
| Q |
73 |
taaacaccattgagtttgattgaatactaaccaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacag |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||| |
|
|
| T |
45363087 |
taaacaccattgagttttattgaatactaaccaagactgaacatggccatgccaagccctgcatccgacaatatggaaatagactttgctatgataacag |
45362988 |
T |
|
| Q |
173 |
gcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaatatgtgtttgggtt |
245 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45362987 |
gcatttcaatattccacctgaatgaaatgagtgaccaagttaggccgataatgctcgaatatgtgtttgggtt |
45362915 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 12 - 42
Target Start/End: Complemental strand, 45363267 - 45363237
Alignment:
| Q |
12 |
atgaacagaatcataaaggaaaaggagcaaa |
42 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
45363267 |
atgaacagaatcataaaggaaaaggagcaaa |
45363237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 102 - 184
Target Start/End: Complemental strand, 25040782 - 25040700
Alignment:
| Q |
102 |
accaagactgtacatggccatgccaagccctgcatctgacaatatggaaatagacttttctatgataacaggcatttcaatat |
184 |
Q |
| |
|
|||||||||| |||| ||||||||||| ||||||||||||| ||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
25040782 |
accaagactgaacatagccatgccaagtcctgcatctgacagaatggaaatagactttgctataatggcaggcatttcaatat |
25040700 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University