View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_22 (Length: 260)
Name: NF0254_low_22
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_22 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 19 - 231
Target Start/End: Original strand, 1781424 - 1781636
Alignment:
| Q |
19 |
atgaaattatagtacacctagagagaatttagtgtattttaaaaggaaaagaaaattatcaaagcatcgtgatcttgttgtttcacaaacacaaaactct |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
1781424 |
atgaaattatagtacacctagagagaatttagtgtattttaaaaggaaaagaaaattatcaaagcatcgcgatcttgttgtttcacaaacacaaaactct |
1781523 |
T |
 |
| Q |
119 |
ttcttacaaaatctgcaatagtgttagaacctcctcatagatcgattcaaacaaaacgcaatggattcttctcacatgacgtcacttcccgaagacatca |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1781524 |
ttcttacaaaatctgcaatagtgttagaacctcctcatagatcgattcaaacaaaacgcaatggattcttctcacatgacgtcacttcccgaagacatca |
1781623 |
T |
 |
| Q |
219 |
ccgacgatcaacc |
231 |
Q |
| |
|
||||||||||||| |
|
|
| T |
1781624 |
ccgacgatcaacc |
1781636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University