View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_23 (Length: 258)
Name: NF0254_low_23
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_23 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 124; Significance: 7e-64; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 124; E-Value: 7e-64
Query Start/End: Original strand, 66 - 193
Target Start/End: Original strand, 13800403 - 13800530
Alignment:
| Q |
66 |
atgctctgttttacaacaccacaaaaaggcagttacaaatgatattcaacctgaatgtggataatgttagtgccaccaaggacgagcacatccacgcatc |
165 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13800403 |
atgctctattttacaacaccacaaaaaggcagttacaaatgatattcaacctgaatgtggataatgttagtgccaccaaggacgagcacatccacgcatc |
13800502 |
T |
|
| Q |
166 |
gcagtcacaacttgtgccaacttctctg |
193 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
13800503 |
gcagtcacaacttgtgccaacttctctg |
13800530 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 664 times since January 2019
Visitors: 2568