View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_25 (Length: 250)
Name: NF0254_low_25
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0254_low_25 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 207; Significance: 1e-113; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 207; E-Value: 1e-113
Query Start/End: Original strand, 8 - 222
Target Start/End: Original strand, 37926812 - 37927026
Alignment:
| Q |
8 |
tatatatcatctacaaattctgactaatttgagcagtcaaatatcttcattttgataaatactataattatcatcttcttcaattcttgtctcatccaac |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
37926812 |
tatatatcatctacaaattctgactaatttgagcagtcaaatatcttcattttgataaatactataattatcctcttcttcaattcttgtctcatccaac |
37926911 |
T |
 |
| Q |
108 |
aaagtgtcattgtgtacactttttctcaaatctttgactccacttgtctaccctttatgatgttgatgtaaaatcttctcctgagccaaattcataaatt |
207 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
37926912 |
aaagtgtcattgtgtacactttttctcaaatctttgactccacttgtctaccctttatgatgttgatgtaaaatcttctcatgagccaaattcataaatt |
37927011 |
T |
 |
| Q |
208 |
aaactacttctttat |
222 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
37927012 |
aaactacttctttat |
37927026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University