View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0254_low_26 (Length: 239)
Name: NF0254_low_26
Description: NF0254
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0254_low_26 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 4e-71; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 4e-71
Query Start/End: Original strand, 29 - 180
Target Start/End: Complemental strand, 30128403 - 30128252
Alignment:
Q |
29 |
taagaaaaaccaggacagaatctggagcaaacaacagaagaagcgcagacatttgagggataatggggcacacactacctcaagagacaatattcgggat |
128 |
Q |
|
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
30128403 |
taagaaaaaccagaacagaatctggagcaaacaacagaagaagcgcagacatttgagggataatggggcacacactacctcaagagacaatattcgggat |
30128304 |
T |
 |
Q |
129 |
cccagcacaaaattttcatcactatatcctttattttgtgttcatctcactc |
180 |
Q |
|
|
||||||||||||||||||||||||||| ||||||||||||||| | |||||| |
|
|
T |
30128303 |
cccagcacaaaattttcatcactatatactttattttgtgttcttttcactc |
30128252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 534 times since January 2019
Visitors: 2567